(b) Multiple-tissue northern blot analysis with the 6A3-5 cDNA band in the rat

(b) Multiple-tissue northern blot analysis with the 6A3-5 cDNA band in the rat. proliferation of SMCs in atherosclerotic lesions is the result of an excessive inflammatory fibroproliferative response to various forms of insult to the endothelium. In these diseased vessel walls, SMCs undergo a phenotypic modulation [5, 6] where they change from a highly contractile, fully differentiated, state to a synthetic and/or proliferating dedifferentiated phenotype [4, 7, 8]. Subsequently, SMCs are transformed into foam cells by accumulating lipids [9, 10, 11]. Harvested SMCs, under in vitro conditions, progressively lose their highly contractile phenotype to another phenotype that mimics synthetic SMCs present in diffuse intimal thickening [11, 12]. In long-term cultures, aortic SMCs generate a proliferating transformed phenotype [13, 14] with similarities to proliferating cells [15]. Differences have been observed, at the gene and protein level, between the contractile and the synthetic/proliferating phenotypes. However, at this stage, a greater understanding of the genes implicated in SMC phenotypic differentiation is vital to further understand the pathogenesis of RK-287107 atherosclerosis [16]. In the present study, rat SMCs showing synthetic (subcultures at passage 9) or highly proliferating (spontaneously growing V8 cells) phenotypes were compared with regards to their gene expression by differential display [17]. The rationale for comparing these cell cultures relies on the similar changes in SMC phenotypes that occur in the formation and progression of vascular lesions. Results obtained allowed the identification of a new transcription factor gene, bearing an ARID motif (AT-rich interaction domain), present at high levels in proliferating cultured SMCs. This gene may play an important role in SMC differentiation and proliferation. MATERIALS AND METHODS Surgical procedures and animal care strictly conformed to the Guidelines of the National Institute of Health and Medical Research (decree No 87-848 of 19th October 1987). Sprague-Dawley rats (species: Rattus rattus, strain: OFA, RK-287107 Iffa Credo, France) used in this study were anesthetized with an intraperitoneal injection of pentobarbital (0.11?mL/100?mg body weight). Cell culture RK-287107 Primary aortic SMCs were obtained from explants of medial thoracic aortas from 7 to 8 week-old male Sprague-Dawley rats (250?g) and cultured as previously described [12, 15]. Cell samples were preserved in liquid nitrogen at passages 2C10 and then every 10 passages. SMCs at passage 10 were shown to be in a synthetic state. A spontaneously Mouse monoclonal to PTEN highly proliferating rat smooth muscle cell line, V8, has been used in this study. This cell line was established from aortic media of adult rat and passaged for over 200 times [15]. In stimulation experiments, PMA was given at 50?ng/mL. Total and poly A+ RNA preparation After cell culturing, cells were washed with Hanks medium (Sigma, France), and used for RNA preparation. Total RNA was extracted using the guanidium thiocyanate [18] method. For differential display analysis, genomic DNA contamination was removed by DNase I (MessageClean, GenHunter, Mass, USA). For cDNA library construction and rapid amplification of 5 cDNA ends (5 RACE), poly(A+) RNA was isolated from total RNA using oligo dT30 primers (Oligotex mRNA Kit, Qiagen, France). Differential display analysis Differential display was performed as previously described [17] (RNAimage, GenHunter). Briefly, (i) 0.2?2?only 3.5?probe by RT-PCR (see below): cdk2up: ACGGAGTGGTGTACAAAGCC, cdk2 down: GAGTCTCCAGGGAATAGGGC. 5 rapid RK-287107 amplification of c-DNA ends (5 RACE) To obtain the upstream 5 region of the new gene, the 5 RACE RK-287107 technique was carried out basically by applying the touchdown PCR principle [24] and by using Marathon cDNA amplification and Advantage KlenTaq polymerase kits (Clontech Calif, USA). (i) C.